Orthologous regulated operons containing nadE gene
Regulog: | NadQ - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | NadQ |
Regulation mode: | repressor |
Biological process: | NAD biosynthesis |
Effector: | |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Hyphomonas neptunium ATCC 15444 | ||||
Position: -2
Score: 5.12854 Sequence: AAATGCTCATCATGAGCAATA
Locus tag: HNE_2577
Name: nadE Funciton: NAD synthetase (EC 6.3.1.5) |
||||
nadE | -2 | 5.1 | AAATGCTCATCATGAGCAATA | HNE_2577 |
Oceanicaulis alexandrii HTCC2633 | ||||
Position: -51
Score: 5.78608 Sequence: AAATACTCATCCTGAGCATAA
Locus tag: OA2633_07784
Name: nadE Funciton: NAD synthetase (EC 6.3.1.5) |
||||
nadE | -51 | 5.8 | AAATACTCATCCTGAGCATAA | OA2633_07784 |