Orthologous regulated operons containing HNE_0691 gene
Regulog: | NadQ - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | NadQ |
Regulation mode: | repressor |
Biological process: | NAD biosynthesis |
Effector: | |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Hyphomonas neptunium ATCC 15444 | ||||
Position: -182
Score: 6.38604 Sequence: TTATACTCAAATCGAGCATAA
Locus tag: HNE_0692
Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
Locus tag: HNE_0691
Name: HNE_0691 Funciton: hypothetical protein
Locus tag: HNE_0690
Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
Locus tag: HNE_0689
Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
||||
nadA-HNE_0691-nadB-nadC | -182 | 6.4 | TTATACTCAAATCGAGCATAA | HNE_0692 |