Orthologous regulated operons containing DVU2423 gene
| Regulog: | DVU2423 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | |
| Biological process: | Nitrogen metabolism |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||||
|
Position: -143
Score: 4.09026 Sequence: GTGTGCCCTGCTTTGCATAC
Locus tag: Dret_0703
Name: null Funciton: Transcriptional regulator, HxlR family |
||||
| Dret_0703 | -143 | 4.1 | GTGTGCCCTGCTTTGCATAC | Dret_0703 |
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -35
Score: 4.44409 Sequence: GTCTATAATGTACGGTACAC
Locus tag: Dbac_0456
Name: null Funciton: Transcriptional regulator, HxlR family |
||||
| Dbac_0456 | -35 | 4.4 | GTCTATAATGTACGGTACAC | Dbac_0456 |
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -37
Score: 5.02958 Sequence: TAGTATCCTTTTGGATACCA
Locus tag: DMR_35240
Name: null Funciton: Transcriptional regulator, HxlR family |
||||
| DMR_35240 | -37 | 5 | TAGTATCCTTTTGGATACCA | DMR_35240 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -19
Score: 5.32668 Sequence: TTGTACCCTAGAGGATACCA
Locus tag: DVU2423
Name: null Funciton: Transcriptional regulator, HxlR family |
||||
| DVU2423 | -19 | 5.3 | TTGTACCCTAGAGGATACCA | DVU2423 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -73
Score: 4.9535 Sequence: TAGTATCCTGCGGCATACCA
Locus tag: DvMF_2974
Name: null Funciton: Transcriptional regulator, HxlR family |
||||
| DvMF_2974 | -73 | 5 | TAGTATCCTGCGGCATACCA | DvMF_2974 |