Orthologous regulated operons containing bgrT7 gene
| Regulog: | BgrT7 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | Galactosides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -167
Score: 5.1943 Sequence: TGGTTACTACCAGATAACTT
Position: -145
Score: 5.59532 Sequence: AAGTTAGCTACCGATAACTT
Position: -52
Score: 5.16459 Sequence: TAATTATTAATTGGTAACTT
Locus tag: BDP_1669
Name: bgrT7 Funciton: Predicted beta-galactoside specific transcriptional regulator, TetR family |
||||
| bgrT7 | -167 | 5.2 | TGGTTACTACCAGATAACTT | BDP_1669 |
| -145 | 5.6 | AAGTTAGCTACCGATAACTT | ||
| -52 | 5.2 | TAATTATTAATTGGTAACTT | ||