Orthologous regulated operons containing abfA gene
| Regulog: | AbfR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Arabinose oligosaccharide utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium animalis subsp. lactis AD011 | ||||
|
Position: -113
Score: 6.55606 Sequence: GAAGTACAAGGTTGTACTAG
Locus tag: BLA_0055
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: BLA_0054
Name: abfR Funciton: Transcriptional regulator of arabinofuranosidase, LacI family |
||||
| abfA-abfR | -113 | 6.6 | GAAGTACAAGGTTGTACTAG | BLA_0055 |
| Bifidobacterium longum NCC2705 | ||||
|
Position: -131
Score: 6.55606 Sequence: TCAGTACAAGGTTGTACTAC
Locus tag: BL0544
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: BL0543
Name: abfR Funciton: Transcriptional regulator of arabinofuranosidase, LacI family |
||||
| abfA-abfR | -131 | 6.6 | TCAGTACAAGGTTGTACTAC | BL0544 |