Orthologous regulated operons containing mntD gene

Properties
Regulog:	MntR - Bacillales
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor (activator)
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -92 Score: 6.00787 Sequence: TATGTTGCATTGAGGAAACTTT Locus tag: Aflv_1289 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: Aflv_1290 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: Aflv_1291 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: Aflv_1292 Name: mntD Funciton: Manganese ABC transporter (permease)
mntA-mntB-mntC-mntD	-92	6	TATGTTGCATTGAGGAAACTTT	Aflv_1289
Bacillus clausii KSM-K16
Position: -99 Score: 6.02295 Sequence: AAAGTTGCATTAGAGAAACTTT Locus tag: ABC3961 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: ABC3960 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: ABC3959 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: ABC3958 Name: mntD Funciton: Manganese ABC transporter (permease)
mntA-mntB-mntC-mntD	-99	6	AAAGTTGCATTAGAGAAACTTT	ABC3961
Bacillus halodurans C-125
Position: -180 Score: 6.19625 Sequence: AAAGTTTACTTAGGGAAACTTT Locus tag: BH1389 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: BH1390 Name: mntD Funciton: Manganese ABC transporter (permease)
mntB-mntD	-180	6.2	AAAGTTTACTTAGGGAAACTTT	BH1389
Bacillus pumilus SAFR-032
Position: -119 Score: 5.84273 Sequence: AAAGTTTCCCTAAGGAAACAAA Locus tag: BPUM_3011 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: BPUM_3012 Name: mntD Funciton: Manganese ABC transporter (permease) Locus tag: BPUM_3013 Name: mntA Funciton: Manganase ABC transporter (binding protein)
mntB-mntD-mntA	-119	5.8	AAAGTTTCCCTAAGGAAACAAA	BPUM_3011
Bacillus subtilis subsp. subtilis str. 168
Position: -131 Score: 5.7439 Sequence: AATTTTGCATGAGGGAAACTTT Locus tag: BSU30770 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: BSU30760 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: BSU30750 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: BSU30740 Name: mntD Funciton: Manganese ABC transporter (permease)
mntA-mntB-mntC-mntD	-131	5.7	AATTTTGCATGAGGGAAACTTT	BSU30770
Oceanobacillus iheyensis HTE831
Position: -123 Score: 5.57785 Sequence: AAAGTTTCCTTAGTGCAAAAAA Position: -38 Score: 5.89598 Sequence: AAAGTTTACCTAAGGCAAAATT Locus tag: OB0431 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: OB0432 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: OB0433 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: OB0434 Name: mntD Funciton: Manganese ABC transporter (permease)
mntA-mntB-mntC-mntD	-123	5.6	AAAGTTTCCTTAGTGCAAAAAA	OB0431
	-38	5.9	AAAGTTTACCTAAGGCAAAATT
Paenibacillus sp. JDR-2
Position: -109 Score: 5.50415 Sequence: AATGTTGCATCAGAGAAACATT Locus tag: Pjdr2_4868 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: Pjdr2_4867 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: Pjdr2_4866 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: Pjdr2_4865 Name: mntD Funciton: Manganese ABC transporter (permease)
mntA-mntB-mntC-mntD	-109	5.5	AATGTTGCATCAGAGAAACATT	Pjdr2_4868

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing mntD gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --