Orthologous regulated operons containing feoB1 gene
| Regulog: | MntR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor (activator) |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus cereus ATCC 14579 | ||||
|
Position: -61
Score: 5.8134 Sequence: AAAGTTTACCTTAGGAAACTTT
Locus tag: BC0709
Name: feoA Funciton: Ferrous iron transport protein A
Locus tag: BC0708
Name: feoB1 Funciton: Ferrous iron transport protein B
Locus tag: BC0707
Name: feoB2 Funciton: Ferrous iron transport protein B |
||||
| feoA-feoB1-feoB2 | -61 | 5.8 | AAAGTTTACCTTAGGAAACTTT | BC0709 |