Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing feoA gene

Properties
Regulog: MntR - Bacillales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -61
Score: 5.8134
Sequence: AAAGTTTACCTTAGGAAACTTT
Locus tag: BC0709
Name: feoA
Funciton: Ferrous iron transport protein A
Locus tag: BC0708
Name: feoB1
Funciton: Ferrous iron transport protein B
Locus tag: BC0707
Name: feoB2
Funciton: Ferrous iron transport protein B
feoA-feoB1-feoB2 -61 5.8 AAAGTTTACCTTAGGAAACTTT BC0709