Orthologous regulated operons containing COG2814 gene
| Regulog: | FruR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate; Fructose-1,6-diphosphate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -67
Score: 4.7886 Sequence: ACGCTGATTCGATTCAGCAC
Locus tag: Csal_0500
Name: COG2814 Funciton: Sugar MFS transporter, AraJ family |
||||
| COG2814 | -67 | 4.8 | ACGCTGATTCGATTCAGCAC | Csal_0500 |