Orthologous regulated operons containing fba gene
| Regulog: | FruR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate; Fructose-1,6-diphosphate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -15
Score: 5.01684 Sequence: GAGCTGAATCGTGTCATGCC
Locus tag: Csal_0372
Name: gap Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
Locus tag: Csal_0371
Name: pgk Funciton: Phosphoglycerate kinase (EC 2.7.2.3)
Locus tag: Csal_0370
Name: fba Funciton: Fructose-bisphosphate aldolase class II (EC 4.1.2.13) |
||||
| gap-pgk-fba | -15 | 5 | GAGCTGAATCGTGTCATGCC | Csal_0372 |