Orthologous regulated operons containing pfkB gene
| Regulog: | FruR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose-1-phosphate; Fructose-1,6-diphosphate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -69
Score: 5.78944 Sequence: AAGCTGACACGATTCATCCA
Locus tag: Csal_0932
Name: pgi Funciton: Glucose-6-phosphate isomerase (EC 5.3.1.9)
Locus tag: Csal_0931
Name: pfkB Funciton: Fructokinase (EC 2.7.1.4) |
||||
| pgi-pfkB | -69 | 5.8 | AAGCTGACACGATTCATCCA | Csal_0932 |