Orthologous regulated operons containing PF00903 gene
| Regulog: | SoxR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas atlantica T6c | ||||
|
Position: -66
Score: 5.00345 Sequence: ATCTAAAGTTAGCTTTAGAT
Locus tag: Patl_1581
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
| PF00903 | -66 | 5 | ATCTAAAGTTAGCTTTAGAT | Patl_1581 |