Orthologous regulated operons containing PF03358 gene
| Regulog: | SoxR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonadales bacterium TW-7 | ||||
|
Position: -58
Score: 6.1442 Sequence: ACCTCAATATAACTTGAGGT
Locus tag: ATW7_01927
Name: PF03358 Funciton: NADPH-dependent FMN reductase |
||||
| PF03358 | -58 | 6.1 | ACCTCAATATAACTTGAGGT | ATW7_01927 |