Orthologous regulated operons containing nhoA gene
| Regulog: | SoxR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas tunicata D2 | ||||
|
Position: -186
Score: 6.42585 Sequence: ACCTCAAGTTATCTTGAGGT
Locus tag: PTD2_05755
Name: nhoA Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
||||
| nhoA | -186 | 6.4 | ACCTCAAGTTATCTTGAGGT | PTD2_05755 |