Orthologous regulated operons containing qorD gene
Regulog: | QorR - Streptomycetaceae |
Regulator type: | Transcription factor |
Regulator family: | HxlR |
Regulation mode: | repressor |
Biological process: | Energy metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptomyces avermitilis MA-4680 | ||||
Position: -66
Score: 5.96986 Sequence: GTACTTTCGCTGAGTTAGTGC
Locus tag: SAV_4874
Name: qorD Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
Locus tag: SAV_4873
Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
||||
qorD-qorB | -66 | 6 | GTACTTTCGCTGAGTTAGTGC | SAV_4874 |
Streptomyces coelicolor A3(2) | ||||
Position: -69
Score: 5.23508 Sequence: GCACTATCCTCTGGTTAGCGC
Locus tag: SCO4593
Name: qorD Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
Locus tag: SCO4592
Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
||||
qorD-qorB | -69 | 5.2 | GCACTATCCTCTGGTTAGCGC | SCO4593 |
Streptomyces griseus subsp. griseus NBRC 13350 | ||||
Position: -103
Score: 5.76484 Sequence: GTACTTTCCCATAGTTAGCGC
Locus tag: SGR_2932
Name: qorD Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
Locus tag: SGR_2933
Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
||||
qorD-qorB | -103 | 5.8 | GTACTTTCCCATAGTTAGCGC | SGR_2932 |
Streptomyces scabiei 87.22 | ||||
Position: -68
Score: 5.88905 Sequence: GTACTTTCGCAGAGTTAGCGC
Locus tag: SCAB_37591
Name: qorD Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
Locus tag: SCAB_37601
Name: qorB Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
||||
qorD-qorB | -68 | 5.9 | GTACTTTCGCAGAGTTAGCGC | SCAB_37591 |