Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing HNE_2101 gene

Properties
Regulog: SahR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Hyphomonas neptunium ATCC 15444
Position: -27
Score: 5.04685
Sequence: ATATAAAAGTTCGTTTATAT
Locus tag: HNE_2104
Name: sahR
Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: HNE_2103
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Locus tag: HNE_2102
Name: metH2
Funciton: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
Locus tag: HNE_2101
Name: null
Funciton: hypothetical protein
Locus tag: HNE_2100
Name: metH
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
sahR-metF-metH2-HNE_2101-metH -27 5 ATATAAAAGTTCGTTTATAT HNE_2104
© 2009-2020 RegPrecise