Orthologous regulated operons containing scrR2 gene
| Regulog: | ScrR2 - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||||
|
Position: -130
Score: 6.52087 Sequence: TTTTGGAACCGTTTCCATTT
Locus tag: LEUM_0287
Name: scrR2 Funciton: Predicted sucrose utilization regulator ScrR2, LacI family |
||||
| scrR2 | -130 | 6.5 | TTTTGGAACCGTTTCCATTT | LEUM_0287 |