Orthologous regulated operons containing mdeA gene
| Regulog: | TyrR2 - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Tyrosine degradation; Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina baltica OS145 | ||||
|
Position: -140
Score: 5.16879 Sequence: GTGGAAAAATAGCGTTACAG
Locus tag: OS145_07157
Name: mdeA Funciton: Methionine gamma-lyase (EC 4.4.1.11)
Locus tag: OS145_07152
Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: OS145_07147
Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
||||
| mdeA-phhA-phhB | -140 | 5.2 | GTGGAAAAATAGCGTTACAG | OS145_07157 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -119
Score: 5.21703 Sequence: GTGGAAAACTAGCGTTACAG
Locus tag: IL0726
Name: mdeA Funciton: Methionine gamma-lyase (EC 4.4.1.11)
Locus tag: IL0725
Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: IL0724
Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Locus tag: IL0723
Name: tyrR2 Funciton: Tyrosine and phenylalanine degradation transcriptional activator, TyrR family |
||||
| mdeA-phhA-phhB-tyrR2 | -119 | 5.2 | GTGGAAAACTAGCGTTACAG | IL0726 |