Orthologous regulated operons containing modE2 gene
Regulog: | ModE2 - Flavobacteria |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | |
Biological process: | Molybdopterin biosynthesis |
Effector: | Molybdate |
Phylum: | Bacteroidetes |
![](logos/6000_large.png)
Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Leeuwenhoekiella blandensis MED217 | ||||
Position: -33
Score: 6.76833 Sequence: CGTTATATTCGCTAAAACATAACG
Locus tag: MED217_08765
Name: moeA Funciton: Molybdopterin biosynthesis protein MoeA
Locus tag: MED217_08760
Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
Locus tag: MED217_08755
Name: mobA Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: MED217_08750
Name: moaD Funciton: Molybdenum cofactor biosynthesis protein MoaD
Locus tag: MED217_08745
Name: moeB Funciton: Molybdopterin biosynthesis protein MoeB
Locus tag: MED217_08740
Name: moaE Funciton: Molybdenum cofactor biosynthesis protein MoaE
Locus tag: MED217_08735
Name: moaCB Funciton: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
Locus tag: MED217_08730
Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA |
||||
moeA-modE2-mobA-moaD-moeB-moaE-moaCB-moaA | -33 | 6.8 | CGTTATATTCGCTAAAACATAACG | MED217_08765 |