Orthologous regulated operons containing SJA_C1-05350 gene
Regulog: | CadR-PbrR - Sphingomonadales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Lead resistance; Cadmium resistance |
Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
Phylum: | Proteobacteria/Alpha |
![](logos/5210_large.png)
Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Sphingobium japonicum UT26S | ||||
Position: -35
Score: 5.29693 Sequence: CTTCTACAGCGACTGGAGGTG
Locus tag: SJA_C1-05430
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: SJA_C1-05420
Name: pbrT Funciton: Pb(II) uptake protein, ILT family
Locus tag: SJA_C1-05410
Name: null Funciton: hypothetical protein
Locus tag: SJA_C1-05400
Name: czcC Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: SJA_C1-05390
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: SJA_C1-05380
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: SJA_C1-05370
Name: null Funciton: hypothetical protein
Locus tag: SJA_C1-05360
Name: null Funciton: hypothetical protein
Locus tag: SJA_C1-05350
Name: null Funciton: hypothetical protein
Locus tag: SJA_C1-05340
Name: PF02535 Funciton: Putative metal transporter
Locus tag: SJA_C1-05330
Name: czcD2 Funciton: Co/Zn/Cd efflux protein
Locus tag: SJA_C1-05320
Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
||||
czcD-pbrT-SJA_C1-05410-czcC-czcB-czcA-SJA_C1-05370-SJA_C1-05360-SJA_C1-05350-PF02535-czcD2-cadA | -35 | 5.3 | CTTCTACAGCGACTGGAGGTG | SJA_C1-05430 |