Orthologous regulated operons containing lysW gene
| Regulog: | LysX - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrmB |
| Regulation mode: | |
| Biological process: | Lysine biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -144
Score: 5.38544 Sequence: GGCGTTCTAAAGAGTACCAC
Locus tag: Dde_0208
Name: lysW Funciton: lysine transporter from the Na+/H+ antiporter superfamily |
||||
| lysW | -144 | 5.4 | GGCGTTCTAAAGAGTACCAC | Dde_0208 |