Orthologous regulated operons containing DVU3081 gene
| Regulog: | LysX - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrmB |
| Regulation mode: | |
| Biological process: | Lysine biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -83
Score: 5.87532 Sequence: GTATTTCTATTTAGTACCAC
Locus tag: Dde_0301
Name: null Funciton: Permease of the drug/metabolite transporter (DMT) superfamily |
||||
| Dde_0301 | -83 | 5.9 | GTATTTCTATTTAGTACCAC | Dde_0301 |