Orthologous regulated operons containing mviN-1 gene
| Regulog: | LysX - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrmB |
| Regulation mode: | |
| Biological process: | Lysine biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -274
Score: 5.1758 Sequence: GTAGTTGTGATAAGAAACAC
Locus tag: Dde_2468
Name: mviN-1 Funciton: integral membrane protein MviN |
||||
| mviN-1 | -274 | 5.2 | GTAGTTGTGATAAGAAACAC | Dde_2468 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -134
Score: 5.76022 Sequence: GTGGTTCTTTGTAGTACTAC
Locus tag: DVU1173
Name: mviN-1 Funciton: integral membrane protein MviN |
||||
| mviN-1 | -134 | 5.8 | GTGGTTCTTTGTAGTACTAC | DVU1173 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -328
Score: 5.55912 Sequence: GTGGTTTCGTATAGTACCAC
Locus tag: DvMF_3067
Name: mviN-1 Funciton: integral membrane protein MviN |
||||
| mviN-1 | -328 | 5.6 | GTGGTTTCGTATAGTACCAC | DvMF_3067 |