Orthologous regulated operons containing DVU1170 gene
| Regulog: | LysX - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrmB |
| Regulation mode: | |
| Biological process: | Lysine biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -385
Score: 5.1758 Sequence: GTGTTTCTTATCACAACTAC
Locus tag: Dde_2470
Name: null Funciton: hypothetical protein |
||||
| Dde_2470 | -385 | 5.2 | GTGTTTCTTATCACAACTAC | Dde_2470 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -491
Score: 5.76022 Sequence: GTAGTACTACAAAGAACCAC
Locus tag: DVU1170
Name: null Funciton: hypothetical protein |
||||
| DVU1170 | -491 | 5.8 | GTAGTACTACAAAGAACCAC | DVU1170 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -529
Score: 5.55912 Sequence: GTGGTACTATACGAAACCAC
Locus tag: DvMF_3066
Name: null Funciton: hypothetical protein |
||||
| DvMF_3066 | -529 | 5.6 | GTGGTACTATACGAAACCAC | DvMF_3066 |