Orthologous regulated operons containing lysA-2 gene
Regulog: | LysX - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | TrmB |
Regulation mode: | |
Biological process: | Lysine biosynthesis |
Effector: | |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfovibrio desulfuricans G20 | ||||
Position: -42
Score: 6.37518 Sequence: GTAGTACTAAATAGTACCAC
Locus tag: Dde_2665
Name: lysX Funciton: Transcriptional regulator, TrmB family
Locus tag: Dde_2664
Name: lysA-2 Funciton: Diaminopimelate decarboxylase (EC 4.1.1.20) |
||||
lysX-lysA-2 | -42 | 6.4 | GTAGTACTAAATAGTACCAC | Dde_2665 |
Desulfovibrio vulgaris Hildenborough | ||||
Position: -278
Score: 6.49833 Sequence: GTGGTACTAATCAGTACCAC
Locus tag: DVU2567
Name: lysX Funciton: Transcriptional regulator, TrmB family
Locus tag: DVU2566
Name: lysA-2 Funciton: Diaminopimelate decarboxylase (EC 4.1.1.20) |
||||
lysX-lysA-2 | -278 | 6.5 | GTGGTACTAATCAGTACCAC | DVU2567 |
Desulfovibrio vulgaris str. Miyazaki F | ||||
Position: -265
Score: 6.06751 Sequence: GTAGTACCAATCAGTACCAC
Locus tag: DvMF_1011
Name: lysX Funciton: Transcriptional regulator, TrmB family
Locus tag: DvMF_1010
Name: lysA-2 Funciton: Diaminopimelate decarboxylase (EC 4.1.1.20) |
||||
lysX-lysA-2 | -265 | 6.1 | GTAGTACCAATCAGTACCAC | DvMF_1011 |