Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dde_1590 gene

Properties
Regulog: Rex - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Built upon 107 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -83
Score: 4.85868
Sequence: ATTGTGCATTATTTAACTAG
Locus tag: Dde_1591
Name: null
Funciton: metal dependent phosphohydrolase
Locus tag: Dde_1590
Name: null
Funciton: Glycosyl transferase, family 2
Dde_1591-Dde_1590 -83 4.9 ATTGTGCATTATTTAACTAG Dde_1591
Desulfovibrio vulgaris Hildenborough
Position: -54
Score: 4.11731
Sequence: CTTGTGGTGTTTTACACAAA
Locus tag: null
Name: null
Funciton: metal dependent phosphohydrolase
Locus tag: DVU2059
Name: null
Funciton: Glycosyl transferase, family 2
null-DVU2059 -54 4.1 CTTGTGGTGTTTTACACAAA null
© 2009-2020 RegPrecise