Orthologous regulated operons containing Jann_1468 gene
Regulog: | Jann_1459 - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -92
Score: 5.40262 Sequence: GTATGTAATCGATTTCAGAG
Locus tag: Jann_1460
Name: null Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1461
Name: Jann_1461 Funciton: oxidoreductase-like
Locus tag: Jann_1462
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Jann_1463
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein
Locus tag: Jann_1464
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Jann_1465
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1466
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1467
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: Jann_1468
Name: null Funciton: oxidoreductase-like |
||||
Jann_1460-Jann_1461-COG1082-SMb20720-SMb20718-SMb20719-SMb20719-COG0673-Jann_1468 | -92 | 5.4 | GTATGTAATCGATTTCAGAG | Jann_1460 |