Orthologous regulated operons containing OB2597_08874 gene
Regulog: | Jann_1459 - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Oceanicola batsensis HTCC2597 | ||||
Position: -50
Score: 5.07918 Sequence: GGATGTAATCGATTTCAAGG
Locus tag: OB2597_08884
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: OB2597_08879
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: OB2597_08874
Name: null Funciton: Putative isomerase/epimerase
Locus tag: OB2597_08869
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: OB2597_08864
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08859
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08854
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein |
||||
COG1082-COG0673-OB2597_08874-SMb20718-SMb20719-SMb20719-SMb20720 | -50 | 5.1 | GGATGTAATCGATTTCAAGG | OB2597_08884 |