Orthologous regulated operons containing SMb20719 gene
Regulog: | Jann_1459 - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Jannaschia sp. CCS1 | ||||
Position: -92
Score: 5.40262 Sequence: GTATGTAATCGATTTCAGAG
Locus tag: Jann_1460
Name: null Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1461
Name: Jann_1461 Funciton: oxidoreductase-like
Locus tag: Jann_1462
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Jann_1463
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein
Locus tag: Jann_1464
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Jann_1465
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1466
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1467
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: Jann_1468
Name: null Funciton: oxidoreductase-like |
||||
Jann_1460-Jann_1461-COG1082-SMb20720-SMb20718-SMb20719-SMb20719-COG0673-Jann_1468 | -92 | 5.4 | GTATGTAATCGATTTCAGAG | Jann_1460 |
Oceanicola batsensis HTCC2597 | ||||
Position: -50
Score: 5.07918 Sequence: GGATGTAATCGATTTCAAGG
Locus tag: OB2597_08884
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: OB2597_08879
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: OB2597_08874
Name: null Funciton: Putative isomerase/epimerase
Locus tag: OB2597_08869
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: OB2597_08864
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08859
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08854
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein |
||||
COG1082-COG0673-OB2597_08874-SMb20718-SMb20719-SMb20719-SMb20720 | -50 | 5.1 | GGATGTAATCGATTTCAAGG | OB2597_08884 |
Paracoccus denitrificans PD1222 | ||||
Position: -54
Score: 4.91066 Sequence: GTTTGCAATCGATTGCAGAC
Locus tag: Pden_4767
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Pden_4768
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: Pden_4769
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Pden_4770
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: Pden_4771
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein |
||||
COG1082-COG0673-SMb20718-SMb20719-SMb20720 | -54 | 4.9 | GTTTGCAATCGATTGCAGAC | Pden_4767 |
Rhodobacter sphaeroides 2.4.1 | ||||
Position: -109
Score: 4.3248 Sequence: CGTTGTAAACGTTTGTCGCG
Position: -77
Score: 5.70327 Sequence: CTCTGCAAACGATTACATCA
Locus tag: RSP_1244
Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
Locus tag: RSP_1245
Name: COG0673 Funciton: Predicted dehydrogenases and related proteins
Locus tag: RSP_1247
Name: SMb20718 Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: RSP_6150
Name: SMb20719 Funciton: SugarABC transport system, inner membrane protein
Locus tag: RSP_1249
Name: SMb20720 Funciton: Sugar ABC transport system, substrate-binding protein |
||||
COG1082-COG0673-SMb20718-SMb20719-SMb20720 | -109 | 4.3 | CGTTGTAAACGTTTGTCGCG | RSP_1244 |
-77 | 5.7 | CTCTGCAAACGATTACATCA |