Orthologous regulated operons containing aglA gene
| Regulog: | DR2501 - Deinococcus-Thermus |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Deinococcus-Thermus |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Deinococcus geothermalis DSM 11300 | ||||
|
Position: -47
Score: 6.03182 Sequence: GAACTGAATCGATTCAGTCG
Locus tag: Dgeo_0672
Name: aglA Funciton: putative alpha-glucosidase (EC 3.2.1.20) |
||||
| aglA | -47 | 6 | GAACTGAATCGATTCAGTCG | Dgeo_0672 |
| Deinococcus radiodurans R1 | ||||
|
Position: 55
Score: 6.10168 Sequence: CATCTGAAACGATTCAGTCC
Locus tag: DR1375
Name: aglA Funciton: putative alpha-glucosidase (EC 3.2.1.20) |
||||
| aglA | 55 | 6.1 | CATCTGAAACGATTCAGTCC | DR1375 |