Orthologous regulated operons containing amyB gene
Regulog: | MalR2 - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium botulinum A str. ATCC 3502 | ||||
Position: -154
Score: 5.64224 Sequence: TTGTGCAAACGATTTCACTA
Locus tag: CBO1203
Name: amyB Funciton: Beta-amylase precursor (EC 3.2.1.2) |
||||
amyB | -154 | 5.6 | TTGTGCAAACGATTTCACTA | CBO1203 |