Orthologous regulated operons containing amyE gene
Regulog: | MalR2 - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium beijerincki NCIMB 8052 | ||||
Position: -177
Score: 5.86375 Sequence: TTGTGCAACCGATTGCAATA
Position: -39
Score: 5.56981 Sequence: TTTTGCAACCGATTGCGCTA
Locus tag: Cbei_0664
Name: amyE Funciton: Alpha-amylase (EC 3.2.1.1) |
||||
amyE | -177 | 5.9 | TTGTGCAACCGATTGCAATA | Cbei_0664 |
-39 | 5.6 | TTTTGCAACCGATTGCGCTA |