Orthologous regulated operons containing malM gene
Regulog: | MalR2 - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium beijerincki NCIMB 8052 | ||||
Position: -89
Score: 6.40505 Sequence: TTGCGCAAGCGATTGCTTTA
Locus tag: Cbei_0233
Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
||||
malM | -89 | 6.4 | TTGCGCAAGCGATTGCTTTA | Cbei_0233 |
Clostridium butyricum 5521 | ||||
Position: -55
Score: 6.25335 Sequence: TTATGCAAGCGATTGCTTAG
Locus tag: CBY_2943
Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) |
||||
malM | -55 | 6.3 | TTATGCAAGCGATTGCTTAG | CBY_2943 |