Orthologous regulated operons containing malE gene
Regulog: | MalR2 - Clostridia-1 |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Clostridium beijerincki NCIMB 8052 | ||||
Position: -139
Score: 5.95672 Sequence: TTTCGCAATCGTTTGCGAAA
Locus tag: Cbei_0230
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component
Locus tag: Cbei_0231
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: Cbei_0232
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 |
||||
malE-malF-malG | -139 | 6 | TTTCGCAATCGTTTGCGAAA | Cbei_0230 |
Clostridium butyricum 5521 | ||||
Position: -108
Score: 6.46562 Sequence: TTTTGCAAGCGATTGCATAT
Locus tag: CBY_2940
Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding component
Locus tag: CBY_2941
Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: CBY_2942
Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 |
||||
malE-malF-malG | -108 | 6.5 | TTTTGCAAGCGATTGCATAT | CBY_2940 |