Orthologous regulated operons containing lldR gene
Regulog: | LldR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Lactate utilization |
Effector: | L-lactate |
Phylum: | Proteobacteria/alpha |
![](logos/1795_large.png)
Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Paracoccus denitrificans PD1222 | ||||
Position: -133
Score: 6.54946 Sequence: TTGGTAAAATAATTTGACCAT
Locus tag: Pden_2929
Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family |
||||
lldR | -133 | 6.5 | TTGGTAAAATAATTTGACCAT | Pden_2929 |
Rhodobacterales bacterium HTCC2654 | ||||
Position: -170
Score: 5.31238 Sequence: GTGGTAAATATTATTGACCAC
Locus tag: RB2654_23238
Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family |
||||
lldR | -170 | 5.3 | GTGGTAAATATTATTGACCAC | RB2654_23238 |