Orthologous regulated operons containing DMR_27630 gene
| Regulog: | TunR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TunR |
| Regulation mode: | activator |
| Biological process: | Tungsten homeostasis; Molybdenum homeostasis |
| Effector: | Molybdate; Tungsten |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -328
Score: 5.16303 Sequence: CTGTCATGTGAATAGAATTATTCGTGACAG
Locus tag: DMR_27630
Name: null Funciton: putative TonB-dependent receptor
Locus tag: DMR_27640
Name: null Funciton: hypothetical membrane protein
Locus tag: DMR_27650
Name: null Funciton: putative ABC transporter ATP-binding protein
Locus tag: DMR_27660
Name: null Funciton: hypothetical membrane protein |
||||
| DMR_27630-DMR_27640-DMR_27650-DMR_27660 | -328 | 5.2 | CTGTCATGTGAATAGAATTATTCGTGACAG | DMR_27630 |