Orthologous regulated operons containing tupB gene
| Regulog: | TunR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TunR |
| Regulation mode: | activator |
| Biological process: | Tungsten homeostasis; Molybdenum homeostasis |
| Effector: | Molybdate; Tungsten |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -117
Score: 4.58609 Sequence: TGTGCACGTTTTCTGCTTGTTTCGTGACTG
Locus tag: DvMF_2780
Name: tupB Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: DvMF_2781
Name: tupA Funciton: ABC-type tungstate transport system, permease protein
Locus tag: DvMF_2782
Name: tupC Funciton: ABC-type tungstate transport system, ATP-binding protein |
||||
| tupB-tupA-tupC | -117 | 4.6 | TGTGCACGTTTTCTGCTTGTTTCGTGACTG | DvMF_2780 |