Orthologous regulated operons containing modA gene

Properties
Regulog:	TunR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Phylum:	Proteobacteria/delta

Built upon 37 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -134 Score: 6.53314 Sequence: CTGTCACGCATTTTATTTTTTTCGTGACCG Locus tag: Dde_0155 Name: modA Funciton: ABC-type molybdate transport system, periplasmic component Locus tag: Dde_0154 Name: modB Funciton: ABC-type molybdate transport system, permease component Locus tag: Dde_0153 Name: null Funciton: hypothetical protein
modA-modB-Dde_0153	-134	6.5	CTGTCACGCATTTTATTTTTTTCGTGACCG	Dde_0155
Desulfovibrio magneticus RS-1
Position: -213 Score: 4.33689 Sequence: ATATCACGAATAATACCCTGTACGTGTCAG Position: -160 Score: 3.75668 Sequence: CTGTCACTTGTTTTGTATTTGCCGTGTCGT Locus tag: DMR_19510 Name: null Funciton: putative esterase Locus tag: DMR_19520 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) Locus tag: DMR_19530 Name: modA Funciton: ABC-type molybdate transport system, periplasmic component Locus tag: DMR_19540 Name: modB Funciton: ABC-type molybdate transport system, permease component
DMR_19510-modC-modA-modB	-213	4.3	ATATCACGAATAATACCCTGTACGTGTCAG	DMR_19510
	-160	3.8	CTGTCACTTGTTTTGTATTTGCCGTGTCGT
Desulfovibrio salexigens DSM 2638
Position: -119 Score: 6.46537 Sequence: CAGTCACGTTTTTATTAGAATGCGTGACCG Locus tag: Desal_0306 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Desal_0305 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Desal_0304 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) Locus tag: Desal_0303 Name: modA Funciton: ABC-type molybdate transport system, periplasmic component Locus tag: Desal_0302 Name: modB Funciton: ABC-type molybdate transport system, permease component Locus tag: Desal_0301 Name: null Funciton: hypothetical protein
modA-modB-modC-modA-modB-Desal_0301	-119	6.5	CAGTCACGTTTTTATTAGAATGCGTGACCG	Desal_0306