Orthologous regulated operons containing susC2 gene
| Regulog: | SusR2 - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | repressor |
| Biological process: | Starch utilization |
| Effector: | |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||||
|
Position: -208
Score: 5.66621 Sequence: ATTTTTACTACTTTTTTGGA
Position: -131
Score: 6.16593 Sequence: AAAACTACTACTTTTTCACT
Locus tag: BACCELL_04952
Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding
Locus tag: BACCELL_04951
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding |
||||
| susC2-susD2 | -208 | 5.7 | ATTTTTACTACTTTTTTGGA | BACCELL_04952 |
| -131 | 6.2 | AAAACTACTACTTTTTCACT | ||
| Bacteroides ovatus ATCC 8483 | ||||
|
Position: -204
Score: 6.58591 Sequence: AAAATCACTACTTTTTTAGT
Position: -127
Score: 5.94747 Sequence: TAAATCACTATATTTTTGCT
Locus tag: BACOVA_02787
Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding
Locus tag: BACOVA_02786
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
Locus tag: BACOVA_02785
Name: susE2 Funciton: Outer membrane protein SusE2
Locus tag: BACOVA_02784
Name: dexA Funciton: Dextranase (EC 3.2.1.11)
Locus tag: BACOVA_02783
Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84) |
||||
| susC2-susD2-susE2-dexA-gaa | -204 | 6.6 | AAAATCACTACTTTTTTAGT | BACOVA_02787 |
| -127 | 5.9 | TAAATCACTATATTTTTGCT | ||
| Bacteroides stercoris ATCC 43183 | ||||
|
Position: -350
Score: 6.1125 Sequence: ATTTTTACTACTTTTTTAGT
Position: -273
Score: 6.30187 Sequence: TAAATCACTACTTTTTCACT
Locus tag: BACSTE_01926
Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding
Locus tag: BACSTE_01925
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
Locus tag: BACSTE_01924
Name: susE2 Funciton: Outer membrane protein SusE2
Locus tag: BACSTE_01923
Name: agaL Funciton: Alpha-galactosidase
Locus tag: BACSTE_01922
Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
Locus tag: BACSTE_01921
Name: susB2 Funciton: Alpha-glucosidase SusB2 (EC 3.2.1.20) |
||||
| susC2-susD2-susE2-agaL-gaa-susB2 | -350 | 6.1 | ATTTTTACTACTTTTTTAGT | BACSTE_01926 |
| -273 | 6.3 | TAAATCACTACTTTTTCACT | ||
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -186
Score: 6.14442 Sequence: AAATCCACTACTTTTTTAGC
Position: -109
Score: 5.8819 Sequence: TAAACCACTATATTTTTGCT
Locus tag: BT3090
Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding
Locus tag: BT3089
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
Locus tag: BT3088
Name: susE2 Funciton: Outer membrane protein SusE2
Locus tag: BT3087
Name: dexA Funciton: Dextranase (EC 3.2.1.11)
Locus tag: BT3086
Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84) |
||||
| susC2-susD2-susE2-dexA-gaa | -186 | 6.1 | AAATCCACTACTTTTTTAGC | BT3090 |
| -109 | 5.9 | TAAACCACTATATTTTTGCT | ||
| Bacteroides uniformis ATCC 8492 | ||||
|
Position: -206
Score: 6.24845 Sequence: ATTTTCACTACTTTTTTAGT
Position: -129
Score: 6.45477 Sequence: TAAACCACTACTTTTTTACT
Locus tag: BACUNI_01942
Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding
Locus tag: BACUNI_01943
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
Locus tag: BACUNI_01944
Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
Locus tag: BACUNI_01945
Name: susE2 Funciton: Outer membrane protein SusE2
Locus tag: BACUNI_01946
Name: dexA Funciton: Dextranase (EC 3.2.1.11)
Locus tag: BACUNI_01947
Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
Locus tag: BACUNI_01948
Name: susB2 Funciton: Alpha-glucosidase SusB2 (EC 3.2.1.20) |
||||
| susC2-susD2-susD2-susE2-dexA-gaa-susB2 | -206 | 6.2 | ATTTTCACTACTTTTTTAGT | BACUNI_01942 |
| -129 | 6.5 | TAAACCACTACTTTTTTACT | ||