Orthologous regulated operons containing copZ gene
Regulog: | FlpA - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | CRP |
Regulation mode: | activator (repressor) |
Biological process: | Heavy metal resistance |
Effector: | Oxygen |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Lactococcus lactis subsp. cremoris SK11 | ||||
Position: -76
Score: 6.02079 Sequence: TAATTGATACAAATCAATTT
Locus tag: LACR_1043
Name: copZ Funciton: Copper chaperone
Locus tag: LACR_1044
Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Locus tag: LACR_1045
Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family |
||||
copZ-dps-flpA | -76 | 6 | TAATTGATACAAATCAATTT | LACR_1043 |
Lactococcus lactis subsp. lactis Il1403 | ||||
Position: -88
Score: 5.71454 Sequence: TTCTTGATGTAAATCAATGT
Locus tag: L134080
Name: copZ Funciton: Copper chaperone |
||||
copZ | -88 | 5.7 | TTCTTGATGTAAATCAATGT | L134080 |