Orthologous regulated operons containing sorM gene
| Regulog: | SorC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | activator (repressor) |
| Biological process: | Sorbose utilization |
| Effector: | Sorbose |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
|
Position: -28
Score: 6.46445 Sequence: ATTTGCACAAATGTGCAGGA
Locus tag: KPN_04408
Name: sorC Funciton: Sorbitol utilization transcriptional regulator, SorC family
Locus tag: KPN_04407
Name: sorD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140)
Locus tag: KPN_04406
Name: sorF Funciton: Sorbose-specific PTS, EIIA component
Locus tag: KPN_04405
Name: sorB Funciton: Sorbose-specific PTS, EIIB component
Locus tag: KPN_04404
Name: sorA Funciton: Sorbose-specific PTS, EIIC component
Locus tag: KPN_04403
Name: sorM Funciton: Sorbose-specific PTS, EIID component
Locus tag: KPN_04402
Name: sorE Funciton: L-sorbose 1-phosphate reductase (EC 1.1.1.-) |
||||
| sorC-sorD-sorF-sorB-sorA-sorM-sorE | -28 | 6.5 | ATTTGCACAAATGTGCAGGA | KPN_04408 |