Orthologous regulated operons containing SAG1807 gene
Regulog: | SAG1808 - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptococcus agalactiae 2603V/R | ||||
Position: -137
Score: 6.78568 Sequence: TGAGTTAACCGTTTAACTTA
Position: -48
Score: 6.67695 Sequence: TTAGTTAAACGGTTAACTCA
Locus tag: SAG1807
Name: SAG1807 Funciton: Conserved hypothetical protein
Locus tag: SAG1806
Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
Locus tag: SAG1805
Name: SAG1805 Funciton: Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
Locus tag: SAG1804
Name: SAG1804 Funciton: Conserved hypothetical protein
Locus tag: SAG1803
Name: SAG1803 Funciton: Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase |
||||
SAG1807-PF00389-SAG1805-SAG1804-SAG1803 | -137 | 6.8 | TGAGTTAACCGTTTAACTTA | SAG1807 |
-48 | 6.7 | TTAGTTAAACGGTTAACTCA | ||
Streptococcus sanguinis SK36 | ||||
Position: -77
Score: 5.86428 Sequence: TAAGTTAACCGCTTCGCCCA
Locus tag: SSA_2086
Name: SAG1807 Funciton: Conserved hypothetical protein
Locus tag: SSA_2085
Name: PF00389 Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
Locus tag: SSA_2084
Name: SAG1805 Funciton: Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
Locus tag: SSA_2083
Name: SAG1804 Funciton: Conserved hypothetical protein
Locus tag: SSA_2082
Name: SAG1803 Funciton: Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase |
||||
SAG1807-PF00389-SAG1805-SAG1804-SAG1803 | -77 | 5.9 | TAAGTTAACCGCTTCGCCCA | SSA_2086 |