Orthologous regulated operons containing bfrE gene
| Regulog: | BfrR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus gordonii str. Challis substr. CH1 | ||||
|
Position: -88
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAAAA
Position: -30
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAAAA
Locus tag: SGO_1305
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: SGO_1304
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: SGO_1303
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: SGO_1302
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
| bfrE-bfrF-bfrG-bfrA | -88 | 6.5 | AAAATGAAACGTTTCAAAAA | SGO_1305 |
| -30 | 6.5 | AAAATGAAACGTTTCAAAAA | ||
| Streptococcus pneumoniae TIGR4 | ||||
|
Position: -93
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAAAA
Position: -31
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAAAA
Locus tag: SP_1798
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: SP_1797
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: SP_1796
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: SP_1795
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
| bfrF-bfrG-bfrE-bfrA | -93 | 6.5 | AAAATGAAACGTTTCAAAAA | SP_1798 |
| -31 | 6.5 | AAAATGAAACGTTTCAAAAA | ||
| Streptococcus suis 05ZYH33 | ||||
|
Position: -33
Score: 6.05851 Sequence: TTATTGAAACGTTTCACAAG
Locus tag: SSU05_1341
Name: bfrR Funciton: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
Locus tag: SSU05_1340
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: SSU05_1339
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: SSU05_1338
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: SSU05_1337
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
| bfrR-bfrF-bfrG-bfrE-bfrA | -33 | 6.1 | TTATTGAAACGTTTCACAAG | SSU05_1341 |
| Streptococcus uberis 0140J | ||||
|
Position: -85
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAATA
Position: -31
Score: 6.47044 Sequence: AAAATGAAACGTTTCAAAAA
Locus tag: SUB0304
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: SUB0305
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: SUB0306
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: SUB0307
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
| bfrF-bfrG-bfrE-bfrA | -85 | 6.5 | AAAATGAAACGTTTCAAATA | SUB0304 |
| -31 | 6.5 | AAAATGAAACGTTTCAAAAA | ||