Orthologous regulated operons containing bfrR gene
| Regulog: | BfrR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus suis 05ZYH33 | ||||
|
Position: -33
Score: 6.05851 Sequence: TTATTGAAACGTTTCACAAG
Locus tag: SSU05_1341
Name: bfrR Funciton: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
Locus tag: SSU05_1340
Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: SSU05_1339
Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: SSU05_1338
Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: SSU05_1337
Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26) |
||||
| bfrR-bfrF-bfrG-bfrE-bfrA | -33 | 6.1 | TTATTGAAACGTTTCACAAG | SSU05_1341 |