Orthologous regulated operons containing bfrR gene

Properties
Regulog:	BfrR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Firmicutes

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus suis 05ZYH33
Position: -33 Score: 6.05851 Sequence: TTATTGAAACGTTTCACAAG Locus tag: SSU05_1341 Name: bfrR Funciton: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family Locus tag: SSU05_1340 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: SSU05_1339 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: SSU05_1338 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: SSU05_1337 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
bfrR-bfrF-bfrG-bfrE-bfrA	-33	6.1	TTATTGAAACGTTTCACAAG	SSU05_1341

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --