Orthologous regulated operons containing ETAE_3291 gene
| Regulog: | UlaR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Edwardsiella tarda EIB202 | ||||
|
Position: -75
Score: 4.2109 Sequence: CTAGCAATCGTTAAAAATCA
Locus tag: ETAE_3291
Name: null Funciton: hypothetical protein
Locus tag: ETAE_3290
Name: ulaG Funciton: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
Locus tag: ETAE_3289
Name: ulaR Funciton: Ascorbate utilization transcriptional regulator UlaR, DeoR family |
||||
| ETAE_3291-ulaG-ulaR | -75 | 4.2 | CTAGCAATCGTTAAAAATCA | ETAE_3291 |