Orthologous regulated operons containing dexB gene
| Regulog: | MalR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus agalactiae 2603V/R | ||||
|
Position: -75
Score: 5.93037 Sequence: TTACGCAAACGCTTGCACTA
Locus tag: SAG1924
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -75 | 5.9 | TTACGCAAACGCTTGCACTA | SAG1924 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||||
|
Position: -126
Score: 5.7575 Sequence: AAATGCAAGCGATTGCGCTA
Locus tag: Sez_1771
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -126 | 5.8 | AAATGCAAGCGATTGCGCTA | Sez_1771 |
| Streptococcus gallolyticus UCN34 | ||||
|
Position: -72
Score: 6.01881 Sequence: TAACGCAAACGCTTGCGCAA
Locus tag: GALLO_0196
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -72 | 6 | TAACGCAAACGCTTGCGCAA | GALLO_0196 |
| Streptococcus mitis B6 | ||||
|
Position: -75
Score: 6.05162 Sequence: TTAGGCAAACGCTTGCATAA
Locus tag: smi_1761
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -75 | 6.1 | TTAGGCAAACGCTTGCATAA | smi_1761 |
| Streptococcus pneumoniae TIGR4 | ||||
|
Position: -75
Score: 5.79374 Sequence: TTAAGCAAACGCTTGCACAA
Locus tag: SP_0342
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -75 | 5.8 | TTAAGCAAACGCTTGCACAA | SP_0342 |
| Streptococcus pyogenes M1 GAS | ||||
|
Position: -75
Score: 5.77579 Sequence: TTGCGCAAACGATTGCACAA
Locus tag: SPy1973
Name: dexB Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70) |
||||
| dexB | -75 | 5.8 | TTGCGCAAACGATTGCACAA | SPy1973 |