Orthologous regulated operons containing pulA2 gene

Properties
Regulog:	MalR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes

Built upon 80 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus sanguinis SK36
Position: -204 Score: 5.29058 Sequence: AACAGAAAACGTTTGCGTTT Locus tag: SSA_2267 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family Locus tag: SSA_2268 Name: pulA2 Funciton: Pullulanase (EC 3.2.1.41)
malR-pulA2	-204	5.3	AACAGAAAACGTTTGCGTTT	SSA_2267
Streptococcus suis 05ZYH33
Position: -62 Score: 5.70599 Sequence: TTAGGAAAACGTTTGCGCAA Locus tag: SSU05_2133 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SSU05_2134 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SSU05_2135 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: SSU05_2136 Name: malA Funciton: Maltodextrose utilization protein MalA Locus tag: SSU05_2137 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family Locus tag: SSU05_2138 Name: pulA2 Funciton: Pullulanase (EC 3.2.1.41)
malX-malC-malD-malA-malR-pulA2	-62	5.7	TTAGGAAAACGTTTGCGCAA	SSU05_2133

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --