Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malC gene

Properties
Regulog: MalR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 80 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus gordonii str. Challis substr. CH1
Position: -280
Score: 5.48087
Sequence: CAACGAAAACGTTTGCGTAG
Position: -66
Score: 6.03823
Sequence: TTAAGAAAACGTTTGCGTAA
Locus tag: SGO_0104
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SGO_0103
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SGO_0102
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SGO_0101
Name: malA
Funciton: Maltodextrose utilization protein MalA
Locus tag: SGO_0100
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
malX-malC-malD-malA-malR -280 5.5 CAACGAAAACGTTTGCGTAG SGO_0104
-66 6 TTAAGAAAACGTTTGCGTAA
Streptococcus mitis B6
Position: -61
Score: 5.51787
Sequence: AAAGGAAAACGTTTGCGTTT
Locus tag: smi_0133
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: smi_0132
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: smi_0131
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malX-malC-malD -61 5.5 AAAGGAAAACGTTTGCGTTT smi_0133
Streptococcus pneumoniae TIGR4
Position: -61
Score: 5.51787
Sequence: AAAGGAAAACGTTTGCGTTT
Locus tag: SP_2108
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SP_2109
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SP_2110
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malX-malC-malD -61 5.5 AAAGGAAAACGTTTGCGTTT SP_2108
Streptococcus suis 05ZYH33
Position: -62
Score: 5.70599
Sequence: TTAGGAAAACGTTTGCGCAA
Locus tag: SSU05_2133
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SSU05_2134
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SSU05_2135
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SSU05_2136
Name: malA
Funciton: Maltodextrose utilization protein MalA
Locus tag: SSU05_2137
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
Locus tag: SSU05_2138
Name: pulA2
Funciton: Pullulanase (EC 3.2.1.41)
malX-malC-malD-malA-malR-pulA2 -62 5.7 TTAGGAAAACGTTTGCGCAA SSU05_2133