Orthologous regulated operons containing amyA2 gene
Regulog: | MalR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Streptococcus gallolyticus UCN34 | ||||
Position: -74
Score: 6.24597 Sequence: TTACGCAAACGCTTGCGTTA
Locus tag: GALLO_1043
Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1) |
||||
amyA2 | -74 | 6.2 | TTACGCAAACGCTTGCGTTA | GALLO_1043 |
Streptococcus gordonii str. Challis substr. CH1 | ||||
Position: -105
Score: 5.21762 Sequence: CGACGCAAACGTTTGCGTCC
Locus tag: SGO_1075
Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1) |
||||
amyA2 | -105 | 5.2 | CGACGCAAACGTTTGCGTCC | SGO_1075 |
Streptococcus mitis B6 | ||||
Position: -74
Score: 5.8976 Sequence: TTACGCAAACGTTTGAGTAA
Locus tag: smi_0750
Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1) |
||||
amyA2 | -74 | 5.9 | TTACGCAAACGTTTGAGTAA | smi_0750 |
Streptococcus pneumoniae TIGR4 | ||||
Position: -74
Score: 6.17564 Sequence: TTACGCAAACGTTTGCGCTA
Locus tag: SP_1382
Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1) |
||||
amyA2 | -74 | 6.2 | TTACGCAAACGTTTGCGCTA | SP_1382 |
Streptococcus sanguinis SK36 | ||||
Position: -58
Score: 5.11216 Sequence: AGACGCAAACGATTGCGCCT
Locus tag: SSA_1024
Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1) |
||||
amyA2 | -58 | 5.1 | AGACGCAAACGATTGCGCCT | SSA_1024 |