Orthologous regulated operons containing SA0184 gene

Properties
Regulog:	MurR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Phylum:	Firmicutes

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Staphylococcus aureus subsp. aureus N315
Position: -133 Score: 5.41776 Sequence: ATATGTAAGATTATTACAATG Locus tag: SA0184 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SA0185 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SA0186 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SA0187 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-133	5.4	ATATGTAAGATTATTACAATG	SA0184
Staphylococcus capitis SK14
Position: -65 Score: 5.32307 Sequence: AATTGTAAACGTTTAATAATA Locus tag: STACA0001_1175 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: STACA0001_1174 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: STACA0001_1173 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: STACA0001_1172 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-65	5.3	AATTGTAAACGTTTAATAATA	STACA0001_1175
Staphylococcus carnosus subsp. carnosus TM300
Position: -114 Score: 5.56253 Sequence: TATTGTAATAAAATTTCAATT Locus tag: Sca_2140 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: Sca_2139 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: Sca_2138 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: Sca_2137 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-114	5.6	TATTGTAATAAAATTTCAATT	Sca_2140
Staphylococcus epidermidis ATCC 12228
Position: -66 Score: 5.32115 Sequence: AATTGTAAACTTGTTGCAATA Locus tag: SE1888 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SE1889 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SE1890 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SE1891 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-66	5.3	AATTGTAAACTTGTTGCAATA	SE1888
Staphylococcus haemolyticus JCSC1435
Position: -91 Score: 5.64808 Sequence: AATTATAAAAATTATATAATA Locus tag: SH0743 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SH0742 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SH0741 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SH0740 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-91	5.6	AATTATAAAAATTATATAATA	SH0743
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -105 Score: 5.30345 Sequence: ATTTGTAATAAAATTTCATTT Position: -64 Score: 5.5899 Sequence: AATTGTAATACTTTTTCATAT Locus tag: SSP0596 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SSP0595 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SSP0594 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SSP0593 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184-murQ-murT-murR	-105	5.3	ATTTGTAATAAAATTTCATTT	SSP0596
	-64	5.6	AATTGTAATACTTTTTCATAT