Orthologous regulated operons containing SA0184 gene
| Regulog: | MurR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | repressor |
| Biological process: | N-acetylmuramate utilization |
| Effector: | N-acetylmuramate-6-phosphate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -133
Score: 5.41776 Sequence: ATATGTAAGATTATTACAATG
Locus tag: SA0184
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SA0185
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SA0186
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SA0187
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -133 | 5.4 | ATATGTAAGATTATTACAATG | SA0184 |
| Staphylococcus capitis SK14 | ||||
|
Position: -65
Score: 5.32307 Sequence: AATTGTAAACGTTTAATAATA
Locus tag: STACA0001_1175
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: STACA0001_1174
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: STACA0001_1173
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: STACA0001_1172
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -65 | 5.3 | AATTGTAAACGTTTAATAATA | STACA0001_1175 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -114
Score: 5.56253 Sequence: TATTGTAATAAAATTTCAATT
Locus tag: Sca_2140
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: Sca_2139
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: Sca_2138
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: Sca_2137
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -114 | 5.6 | TATTGTAATAAAATTTCAATT | Sca_2140 |
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -66
Score: 5.32115 Sequence: AATTGTAAACTTGTTGCAATA
Locus tag: SE1888
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SE1889
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SE1890
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SE1891
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -66 | 5.3 | AATTGTAAACTTGTTGCAATA | SE1888 |
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -91
Score: 5.64808 Sequence: AATTATAAAAATTATATAATA
Locus tag: SH0743
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SH0742
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SH0741
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SH0740
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -91 | 5.6 | AATTATAAAAATTATATAATA | SH0743 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -105
Score: 5.30345 Sequence: ATTTGTAATAAAATTTCATTT
Position: -64
Score: 5.5899 Sequence: AATTGTAATACTTTTTCATAT
Locus tag: SSP0596
Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SSP0595
Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SSP0594
Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SSP0593
Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family |
||||
| SA0184-murQ-murT-murR | -105 | 5.3 | ATTTGTAATAAAATTTCATTT | SSP0596 |
| -64 | 5.6 | AATTGTAATACTTTTTCATAT | ||